| Basic information from miRBase |
| hairpin accession number: MI0002904 |
| Located between position 151511370 and 151511450 on chromosome X strand - |
| Overlapping with sense strand of (intron 3). |
| (Ensemble: ENSPTRT00000041751) |
| mature miRNAs for MI0002904: |
| ptr-miR-224 (MIMAT0002595): CAAGTCACTAGTGGTTCCGTTTA |
| You can find this miRNA in EMBL: AY866263 (accession: AY866263) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |