| Basic information from miRBase |
| hairpin accession number: MI0008468 |
| Located between position 114241230 and 114241297 on chromosome X strand + |
| Overlapping with sense strand of 5HT2C_PANTR (intron 2). |
| (Ensemble: ENSPTRT00000041367) |
| mature miRNAs for MI0008468: |
| ptr-miR-1264 (MIMAT0007988): CAAGTCTTATTTGAGCACCTGTT |
| You can find this miRNA in ENTREZGENE: MIR1264 (accession: 100316368) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |