| Basic information from miRBase |
| hairpin accession number: MI0015551 |
| Located between position 2402160 and 2402221 on chromosome 3q strand - |
| Overlapping with sense strand of (intron 74). |
| (Ensemble: ENSCINT00000001174) |
| mature miRNAs for MI0015551: |
| cin-miR-4010-5p (MIMAT0016506): AACGTATGTCGAGCAAACAT |
| cin-miR-4010-3p (MIMAT0016507): CAAGTTTGTCGCCATACTTC |
| You can find this miRNA in ENTREZGENE: mir4010-1 (accession: 100499057) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |