Basic information from miRBase |
hairpin accession number: MI0015551 |
Located between position 2402160 and 2402221 on chromosome 3q strand - |
Overlapping with sense strand of (intron 74). |
(Ensemble: ENSCINT00000001174) |
mature miRNAs for MI0015551: |
cin-miR-4010-5p (MIMAT0016506): AACGTATGTCGAGCAAACAT |
cin-miR-4010-3p (MIMAT0016507): CAAGTTTGTCGCCATACTTC |
You can find this miRNA in ENTREZGENE: mir4010-1 (accession: 100499057) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" ![]() |