miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0015552
mature miRNAs for MI0015552:
         cin-miR-4010-5p (MIMAT0016506): AACGTATGTCGAGCAAACAT
         cin-miR-4010-3p (MIMAT0016507): CAAGTTTGTCGCCATACTTC
You can find this miRNA in ENTREZGENE: mir4010-2 (accession: 100499101)

References
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data"