| Basic information from miRBase |
| hairpin accession number: MI0007604 |
| Located between position 109970171 and 109970254 on chromosome 14 strand + |
| mature miRNAs for MI0007604: |
| mml-miR-34b (MIMAT0006174): CAATCACTAACTCCACTGCCAT |
| You can find this miRNA in ENTREZGENE: MIR34B (accession: 100315445) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |