Basic information from miRBase |
hairpin accession number: MI0008632 |
Located between position 110285843 and 110285925 on chromosome 11 strand + |
mature miRNAs for MI0008632: |
ptr-miR-34b (MIMAT0008113): CAATCACTAACTCCACTGCCAT |
You can find this miRNA in ENTREZGENE: MIR34B (accession: 100316148) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |