| Basic information from miRBase |
| hairpin accession number: MI0018040 |
| Located between position 37543721 and 37543804 on chromosome 2 strand - |
| Overlapping with sense strand of Strbp-005 (intron 1). |
| (Ensemble: OTTMUST00000030339) |
| mature miRNAs for MI0018040: |
| mmu-miR-5128 (MIMAT0020639): CAATTGGGGCTGGCGAGATGGCT |
| References |
| [1]Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S, Blood. [Epub prior to print](2011)., "Ordered progression of stage specific miRNA profiles in the mouse B2 B cell lineage" |