| Basic information from miRBase |
| hairpin accession number: MI0008821 |
| Located between position 29997965 and 29998060 on chromosome 14 strand - |
| mature miRNAs for MI0008821: |
| ptr-miR-624 (MIMAT0008284): CACAAGGTATTGGTATTACCT |
| You can find this miRNA in ENTREZGENE: MIR624 (accession: 100316250) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |