Basic information from miRBase |
hairpin accession number: MI0008821 |
Located between position 29997965 and 29998060 on chromosome 14 strand - |
mature miRNAs for MI0008821: |
ptr-miR-624 (MIMAT0008284): CACAAGGTATTGGTATTACCT |
You can find this miRNA in ENTREZGENE: MIR624 (accession: 100316250) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |