Basic information from miRBase |
hairpin accession number: MI0015553 |
Located between position 5615210 and 5615267 on chromosome 5q strand + |
mature miRNAs for MI0015553: |
cin-miR-4011a-5p (MIMAT0016508): CACAGTGGAGGTAAAGATTG |
cin-miR-4011a-3p (MIMAT0016509): CGATTTTTGCTTTCCACTGC |
You can find this miRNA in ENTREZGENE: mir4011a (accession: 100498898) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" ![]() |