| Basic information from miRBase |
| hairpin accession number: MI0008615 |
| Located between position 101456241 and 101456325 on chromosome 14 strand + |
| mature miRNAs for MI0008615: |
| ptr-miR-323 (MIMAT0008097): CACATTACACGGTCGACCTCT |
| You can find this miRNA in ENTREZGENE: MIR323 (accession: 100316139) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |