| Basic information from miRBase |
| hairpin accession number: MI0012653 |
| Located between position 89372940 and 89373007 on chromosome 1 strand - |
| Overlapping with antisense strand of MEX3B (3UTR 2). |
| (Ensemble: ENSECAT00000014024) |
| mature miRNAs for MI0012653: |
| eca-miR-1905a (MIMAT0012897): CACCACGAGCCCTACCACGCGGTAG |
| You can find this miRNA in ENTREZGENE: MIR1905A (accession: 100314778) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |