miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012709
Located between position 42088659 and 42088722 on chromosome 5 strand -
Overlapping with antisense strand of LOC100063974 (3UTR 1).
(Ensemble: ENSECAT00000007269)
mature miRNAs for MI0012709:
         eca-miR-1905b (MIMAT0012957): CACCAGCCCCACTACGCGGTAG
You can find this miRNA in ENTREZGENE: MIR1905B (accession: 100315113)

References
[1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach"