| Basic information from miRBase |
| hairpin accession number: MI0008891 |
| Located between position 57336218 and 57336286 on chromosome 19 strand + |
| mature miRNAs for MI0008891: |
| ptr-miR-99b (MIMAT0008351): CACCCGTAGAACCGACCTTGCG |
| You can find this miRNA in ENTREZGENE: MIR99B (accession: 100316288) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |