Basic information from miRBase |
hairpin accession number: MI0008891 |
Located between position 57336218 and 57336286 on chromosome 19 strand + |
mature miRNAs for MI0008891: |
ptr-miR-99b (MIMAT0008351): CACCCGTAGAACCGACCTTGCG |
You can find this miRNA in ENTREZGENE: MIR99B (accession: 100316288) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |