| Basic information from miRBase |
| hairpin accession number: MI0015754 |
| Located between position 2513017 and 2513067 on chromosome 12q strand + |
| Overlapping with sense strand of (intron 3). |
| (Ensemble: ENSCINT00000025950) |
| mature miRNAs for MI0015754: |
| cin-miR-4197-5p (MIMAT0016816): CACGGTTCAGCTGCATCAGG |
| You can find this miRNA in ENTREZGENE: mir4197 (accession: 100499139) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |