| Basic information from miRBase |
| hairpin accession number: MI0017307 |
| Located between position 74480787 and 74480858 on chromosome 10 strand + |
| Overlapping with sense strand of CCDC109A-002 (intron 1). |
| (Ensemble: OTTHUMT00000048594) |
| mature miRNAs for MI0017307: |
| hsa-miR-4676-5p (MIMAT0019758): GAGCCAGTGGTGAGACAGTGA |
| hsa-miR-4676-3p (MIMAT0019759): CACTGTTTCACCACTGGCTCTT |
| References |
| [1]Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" |