miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0007318
Located between position 20783298 and 20783375 on chromosome 7 strand -
mature miRNAs for MI0007318:
         gga-miR-1591* (MIMAT0007453): TGATTCATTGCCTGGCTCTGC
         gga-miR-1591 (MIMAT0007454): CAGACTTGGCCATGGGTAGGA
You can find this miRNA in ENTREZGENE: MIR1591 (accession: 100315957)

References
[1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach"