miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0003478
Located between position 57663841 and 57663914 on chromosome 16 strand +
mature miRNAs for MI0003478:
         rno-miR-383 (MIMAT0003114): CAGATCAGAAGGTGACTGTGG
         rno-miR-383* (MIMAT0017197): CCACAGCACTGCCTGGTCAGA
You can find this miRNA in ENTREZGENE: Mir383 (accession: 100314072)

References
[1]Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M, BMC Bioinformatics. 6:267(2005)., "Identification of clustered microRNAs using an ab initio prediction method"
[2]Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat"