miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0004636
Located between position 70048219 and 70048302 on chromosome 11 strand +
mature miRNAs for MI0004636:
         mmu-miR-497 (MIMAT0003453): CAGCAGCACACTGTGGTTTGTA
         mmu-miR-497* (MIMAT0017247): CAAACCACACTGTGGTGTTAG
You can find this miRNA in MGI: Mir497 (accession: 3629886)

References
[1]Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I, Nucleic Acids Res. 34:1765-1771(2006)., "The expression profile of microRNAs in mouse embryos"
[2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3]Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
[4]Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H, J Virol. 84:10266-10275(2010)., "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
[5]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"