| Basic information from miRBase |
| hairpin accession number: MI0010734 |
| Located between position 4018489 and 4018572 on chromosome 14 strand + |
| mature miRNAs for MI0010734: |
| gga-miR-2129 (MIMAT0011205): CAGCAGGACTGGCTTTGTTACGA |
| You can find this miRNA in ENTREZGENE: MIR2129 (accession: 100315865) |
| References |
| [1]Rathjen T, Pais H, Sweetman D, Moulton V, Munsterberg A, Dalmay T, FEBS Lett. 583:1422-1426(2009)., "High throughput sequencing of microRNAs in chicken somites" |