miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0006526
Located between position 12404208 and 12404391 on chromosome 1 strand +
mature miRNAs for MI0006526:
         vvi-miR169f (MIMAT0005681): CAGCCAAGGATGACTTGCCGA
You can find this miRNA in ENTREZGENE: MIR169F (accession: 100272075)

References
[1]Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro, Nature. 449:463-467(2007)., "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla"
[2]Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS, BMC Genomics. 10:558(2009)., "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera"