miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0014547
mature miRNAs for MI0014547:
         aly-miR169c (MIMAT0017489): CAGCCAAGGATGACTTGCCGG
         aly-miR169c* (MIMAT0017490): GGCAAGTCATCTCTGGCTATG

References
[1]Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC, Plant Cell. 22:1074-1089(2010)., "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana"
[2]Ma Z, Coruh C, Axtell MJ, Plant Cell. 22:1090-1103(2010)., "Arabidopsis lyrata small RNAs: transient MIRNA and small interfering RNA loci within the Arabidopsis genus"