miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008361
Located between position 4225343 and 4225491 on chromosome SL2.40ch07 strand +
mature miRNAs for MI0008361:
         sly-miR169a (MIMAT0007918): CAGCCAAGGATGACTTGCCGG

References
[1]Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T, Genome Res. 18:1602-1609(2008)., "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening"