| Basic information from miRBase |
| hairpin accession number: MI0015384 |
| Located between position 109289237 and 109289320 on chromosome 1 strand + |
| mature miRNAs for MI0015384: |
| gga-miR-3525 (MIMAT0016382): CAGCCATTCTGCGATTCTGTGA |
| You can find this miRNA in ENTREZGENE: MIR3525 (accession: 100498689) |
| References |
| [1]Wang Y, Brahmakshatriya V, Zhu H, Lupiani B, Reddy SM, Yoon BJ, Gunaratne PH, Kim JH, Chen R, Wang J, Zhou H, BMC Genomics. 10:512(2009)., "Identification of differentially expressed miRNAs in chicken lung and trachea with avian influenza virus infection by a deep sequencing approach" |