| Basic information from miRBase |
| hairpin accession number: MI0005794 |
| mature miRNAs for MI0005794: |
| pta-miR946a* (MIMAT0006791): TGTGGATAGAGAAGGGTTAGT |
| pta-miR946a (MIMAT0005005): CAGCCCTTCTCCTATCCACAA |
| References |
| [1]Lu S, Sun YH, Amerson H, Chiang VL, Plant J. 51:1077-1098(2007)., "MicroRNAs in loblolly pine (Pinus taeda L.) and their association with fusiform rust gall development" |
| [2]Morin RD, Aksay G, Dolgosheina E, Ebhardt HA, Magrini V, Mardis ER, Sahinalp SC, Unrau PJ, Genome Res. 18:571-584(2008)., "Comparative analysis of the small RNA transcriptomes of Pinus contorta and Oryza sativa" |