miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013123
Located between position 9823258 and 9823337 on chromosome 10 strand -
Overlapping with sense strand of (exon 1).
(Ensemble: ENSSSCT00000019903)
mature miRNAs for MI0013123:
         ssc-miR-664-5p (MIMAT0013906): CAGGCTAGGAGAAGTGATTGGAT
         ssc-miR-664-3p (MIMAT0013907): TATTCATTTATCTCCCAGCCTACA
You can find this miRNA in ENTREZGENE: MIR664 (accession: 100498722)

References
[1]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"