| Basic information from miRBase |
| hairpin accession number: MI0011547 |
| Located between position 281939 and 282020 on chromosome Un.004.16 strand + |
| Overlapping with sense strand of SNORA36 (exon 1). |
| (Ensemble: ENSBTAT00000060339) RFAM: RFAM) |
| mature miRNAs for MI0011547: |
| bta-miR-664 (MIMAT0012078): CAGGCTGGGGTGTGTGTGGATG |
| You can find this miRNA in ENTREZGENE: MIR664 (accession: 100313247) |
| References |
| [1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |