| Basic information from miRBase |
| hairpin accession number: MI0006296 |
| Located between position 27990555 and 27990674 on chromosome 7 strand + |
| mature miRNAs for MI0006296: |
| mmu-miR-1191 (MIMAT0005849): CAGTCTTACTATGTAGCCCTA |
| You can find this miRNA in MGI: Mir1191 (accession: 3783364) |
| References |
| [1]Calabrese JM, Seila AC, Yeo GW, Sharp PA, Proc Natl Acad Sci U S A. 104:18097-18102(2007)., "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" |
| [2]Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" |