| Basic information from miRBase |
| hairpin accession number: MI0008597 |
| Located between position 58350670 and 58350754 on chromosome 17 strand - |
| Overlapping with sense strand of XM_511916.2 (intron 1). |
| (Ensemble: ENSPTRT00000017352) |
| mature miRNAs for MI0008597: |
| ptr-miR-301a (MIMAT0008084): CAGTGCAATAGTATTGTCAAAGC |
| You can find this miRNA in ENTREZGENE: MIR301A (accession: 100316455) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |