| Basic information from miRBase |
| hairpin accession number: MI0012752 |
| Located between position 3382779 and 3382875 on chromosome 8 strand + |
| mature miRNAs for MI0012752: |
| eca-miR-301b-5p (MIMAT0013000): GCTGTGACGATGTTGCACTACT |
| eca-miR-301b-3p (MIMAT0013001): CAGTGCAATGATATTGTCAAAGC |
| You can find this miRNA in ENTREZGENE: MIR301B (accession: 100315054) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |