| Basic information from miRBase |
| hairpin accession number: MI0007619 |
| Located between position 65405642 and 65405723 on chromosome 10 strand + |
| mature miRNAs for MI0007619: |
| mml-miR-130b (MIMAT0006187): CAGTGCAATGATGAAAGGGCAT |
| You can find this miRNA in ENTREZGENE: MIR130B (accession: 100315195) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |