| Basic information from miRBase |
| hairpin accession number: MI0008528 |
| Located between position 20248708 and 20248788 on chromosome 22 strand + |
| mature miRNAs for MI0008528: |
| ptr-miR-130b (MIMAT0008026): CAGTGCAATGATGAAAGGGCAT |
| You can find this miRNA in ENTREZGENE: MIR130B (accession: 100316094) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |