| Basic information from miRBase |
| hairpin accession number: MI0008527 |
| Located between position 5956048 and 5956135 on chromosome 11_random strand + |
| mature miRNAs for MI0008527: |
| ptr-miR-130a (MIMAT0008025): CAGTGCAATGTTAAAAGGGCAT |
| You can find this miRNA in ENTREZGENE: MIR130A (accession: 100316093) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |