| Basic information from miRBase |
| hairpin accession number: MI0015738 |
| Located between position 898374 and 898429 on chromosome 10p strand + |
| Overlapping with sense strand of (intron 2). |
| (Ensemble: ENSCINT00000027030) |
| mature miRNAs for MI0015738: |
| cin-miR-4182-5p (MIMAT0016796): CATAATGGAGGTTTTTTACT |
| cin-miR-4182-3p (MIMAT0016797): TCAAAAAATCTGCAGAATG |
| You can find this miRNA in ENTREZGENE: mir4182 (accession: 100499135) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |