miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0017448
Located between position 2251804 and 2251883 on chromosome 4 strand -
Overlapping with sense strand of MXD4-003 (exon 3).
(Ensemble: OTTHUMT00000357529)
mature miRNAs for MI0017448:
         hsa-miR-4800-5p (MIMAT0019978): AGTGGACCGAGGAAGGAAGGA
         hsa-miR-4800-3p (MIMAT0019979): CATCCGTCCGTCTGTCCAC

References
[1]Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"