miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012979
Located between position 40068460 and 40068549 on chromosome X strand +
Overlapping with sense strand of LOC100052289 (intron 1).
(Ensemble: ENSECAT00000011707)
mature miRNAs for MI0012979:
         eca-miR-532-5p (MIMAT0013235): CATGCCTTGAGTGTAGGACCGT
         eca-miR-532-3p (MIMAT0013236): CCTCCCACACCCAAGGCTTGCA
You can find this miRNA in ENTREZGENE: MIR532 (accession: 100314955)

References
[1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach"