Basic information from miRBase |
hairpin accession number: MI0008154 |
Located between position 52212252 and 52212310 on chromosome 9 strand - |
Overlapping with sense strand of (intron 5). |
(Ensemble: ENSCAFT00000031120) |
mature miRNAs for MI0008154: |
cfa-miR-126 (MIMAT0006730): CATTATTACTTTTGGTACGCG |
References |
[1]Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N, Nat Biotechnol. 26:407-415(2008)., "Discovering microRNAs from deep sequencing data using miRDeep" |