miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013148
Located between position 52728146 and 52728225 on chromosome 14 strand +
Overlapping with sense strand of (3UTR 1).
(Ensemble: ENSSSCT00000011096)
mature miRNAs for MI0013148:
         ssc-miR-1306-5p (MIMAT0013937): CCACCTCCCCTGCAAACGTCCA
         ssc-miR-1306-3p (MIMAT0013938): ACGTTGGCTCTGGTGGTGATG
You can find this miRNA in ENTREZGENE: MIR1306 (accession: 100498738)

References
[1]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"