| Basic information from miRBase |
| hairpin accession number: MI0008531 |
| Located between position 134982868 and 134982962 on chromosome 10 strand - |
| mature miRNAs for MI0008531: |
| ptr-miR-1324 (MIMAT0008029): CCAGACAGAATTCTATGCACTTTC |
| You can find this miRNA in ENTREZGENE: MIR1324-1 (accession: 100316096) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |