miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0016805
Located between position 53371348 and 53371413 on chromosome 5 strand -
Overlapping with sense strand of ARL15-003 (intron 4).
(Ensemble: OTTHUMT00000368431)
mature miRNAs for MI0016805:
         hsa-miR-4459 (MIMAT0018981): CCAGGAGGCGGAGGAGGTGGAG

References
[1]Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Yan Au W, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill , Blood. 116:e118-e127(2010)., "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"