| Basic information from miRBase |
| hairpin accession number: MI0016805 |
| Located between position 53371348 and 53371413 on chromosome 5 strand - |
| Overlapping with sense strand of ARL15-003 (intron 4). |
| (Ensemble: OTTHUMT00000368431) |
| mature miRNAs for MI0016805: |
| hsa-miR-4459 (MIMAT0018981): CCAGGAGGCGGAGGAGGTGGAG |
| References |
| [1]Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Yan Au W, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill , Blood. 116:e118-e127(2010)., "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" |