| Basic information from miRBase |
| hairpin accession number: MI0009957 |
| Located between position 30497279 and 30497356 on chromosome 5 strand + |
| Overlapping with sense strand of Hadhb-005 (intron 6). |
| (Ensemble: OTTMUST00000061038) |
| mature miRNAs for MI0009957: |
| mmu-miR-1960 (MIMAT0009433): CCAGTGCTGTTAGAAGAGGGCT |
| You can find this miRNA in MGI: Mir1960 (accession: 3837202) |
| References |
| [1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model" |