| Basic information from miRBase |
| hairpin accession number: MI0008882 |
| Located between position 59668652 and 59668741 on chromosome 19 strand + |
| Overlapping with sense strand of (3UTR 3). |
| (Ensemble: ENSPTRT00000017531) |
| mature miRNAs for MI0008882: |
| ptr-miR-935 (MIMAT0008342): CCAGTTACCGCTTCCGCTACCGC |
| You can find this miRNA in ENTREZGENE: MIR935 (accession: 100316282) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |