miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013156
Located between position 40351581 and 40351660 on chromosome 6 strand +
Overlapping with sense strand of (exon 1).
(Ensemble: ENSSSCT00000021452)
mature miRNAs for MI0013156:
         ssc-miR-935 (MIMAT0013947): CCAGTTACCGCTTCCGCTACCGC
You can find this miRNA in ENTREZGENE: MIR935 (accession: 100498743)

References
[1]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"