| Basic information from miRBase |
| hairpin accession number: MI0017737 |
| Located between position 17142438 and 17142587 on chromosome 3R strand + |
| mature miRNAs for MI0017737: |
| dme-miR-4951-5p (MIMAT0020164): TCGGGTGAGGTTTCTGATGCT |
| dme-miR-4951-3p (MIMAT0020165): CCATCAAAAAACCTCACCCACCA |
| References |
| [1]Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC, Genome Res. 21:203-215(2011)., "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" |