| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0005859 |
| Located between position 15152676 and 15152890 on chromosome 3R strand - |
| mature miRNAs for MI0005859: |
| dme-miR-997-5p (MIMAT0005517): CCCAAACTCGAAGGAGTTTCA |
| dme-miR-997-3p (MIMAT0020897): AAACTCATTCGATTTTGATCA |
| References |
| [1]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" |
| more data |
| Data from CoGemiR |