Basic information from miRBase |
hairpin accession number: MI0015582 |
Located between position 7488678 and 7488731 on chromosome 1q strand + |
mature miRNAs for MI0015582: |
cin-miR-4031-5p (MIMAT0016551): CCCAAAGTGTCGGCGCATAT |
cin-miR-4031-3p (MIMAT0016552): ACATGTACCGTCGCTCTGGG |
You can find this miRNA in ENTREZGENE: mir4031 (accession: 100498913) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |