| Basic information from miRBase |
| hairpin accession number: MI0015475 |
| Located between position 109476482 and 109476546 on chromosome 10 strand - |
| Overlapping with sense strand of D3Z8V1_RAT (exon 25). |
| (Ensemble: ENSRNOT00000067144) |
| mature miRNAs for MI0015475: |
| rno-miR-3594-5p (MIMAT0017898): CCCAGGGCAGAGCAGTGTGAA |
| rno-miR-3594-3p (MIMAT0017899): CACACCGCCTCTGCCCGCTAGT |
| You can find this miRNA in ENTREZGENE: Mir3594 (accession: 100526610) |
| References |
| [1]Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat" |