| Basic information from miRBase |
| hairpin accession number: MI0006309 |
| Located between position 189762313 and 189762397 on chromosome 3 strand + |
| Overlapping with sense strand of XM_516911.2 (intron 14). |
| (Ensemble: ENSPTRT00000029239) |
| mature miRNAs for MI0006309: |
| ptr-miR-1224-5p (MIMAT0005568): GTGAGGACTCGGGAGGTGGAGGGT |
| ptr-miR-1224-3p (MIMAT0005569): CCCCACCTCCTCTCTCCTCAG |
| You can find this miRNA in ENTREZGENE: MIR1224 (accession: 100316024) |
| References |
| [1]Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC, Mol Cell. 28:328-336(2007)., "Mammalian mirtron genes" |