Basic information from miRBase |
hairpin accession number: MI0008425 |
Located between position 9591499 and 9591582 on chromosome 17 strand + |
Overlapping with sense strand of XM_523821.2 (intron 11). |
(Ensemble: ENSPTRT00000017172) |
mature miRNAs for MI0008425: |
ptr-miR-1203 (MIMAT0007957): CCCGGAGCCAGGATGCAGCTC |
You can find this miRNA in ENTREZGENE: MIR1203 (accession: 100316047) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |