miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008425
Located between position 9591499 and 9591582 on chromosome 17 strand +
Overlapping with sense strand of XM_523821.2 (intron 11).
(Ensemble: ENSPTRT00000017172)
mature miRNAs for MI0008425:
         ptr-miR-1203 (MIMAT0007957): CCCGGAGCCAGGATGCAGCTC
You can find this miRNA in ENTREZGENE: MIR1203 (accession: 100316047)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"