| Basic information from miRBase |
| hairpin accession number: MI0015854 |
| Located between position 49812054 and 49812125 on chromosome 19 strand - |
| Overlapping with sense strand of SLC6A16-202 (intron 7). |
| (Ensemble: ENST00000454748) |
| mature miRNAs for MI0015854: |
| hsa-miR-4324 (MIMAT0016876): CCCTGAGACCCTAACCTTAA |
| You can find this miRNA in ENTREZGENE: MIR4324 (accession: 100422979) |
| References |
| [1]Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP, PLoS One. 4:e7192(2009)., "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" |