| Basic information from miRBase |
| hairpin accession number: MI0016971 |
| Located between position 161270489 and 161270554 on chromosome 1 strand + |
| Overlapping with sense strand of Scarna3a-201 (exon 1). |
| (Ensemble: ENSMUST00000158911) |
| mature miRNAs for MI0016971: |
| mmu-miR-1843b-5p (MIMAT0019345): ATGGAGGTCTCTGTCTGACTT |
| mmu-miR-1843b-3p (MIMAT0019346): CCGATCGTTCCCCTCCATAC |
| References |
| [1]Fehniger TA, Wylie T, Germino E, Leong JW, Magrini VJ, Koul S, Keppel CR, Schneider SE, Koboldt DC, Sullivan RP, Heinz ME, Crosby SD, Nagarajan R, Ramsingh G, Link DC, Ley TJ, Mardis ER, Genome Res. 20:1590-1604(2010)., "Next-generation sequencing identifies the natural killer cell microRNA transcriptome" |